Review



plko 1 scrambled control shrna vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc plko 1 scrambled control shrna vector
    Plko 1 Scrambled Control Shrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pm40921794-168-20-27
    Average 93 stars, based on 175 article reviews
    plko 1 scrambled control shrna vector - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer’s patient-derived cortical neurons
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer's patient-derived cortical neurons.
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Sequencing:

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer’s patient-derived cortical neurons
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer's patient-derived cortical neurons.
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Clone Assay:

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer’s patient-derived cortical neurons
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer's patient-derived cortical neurons.
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Plasmid Preparation:

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer’s patient-derived cortical neurons
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer's patient-derived cortical neurons.
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Control:

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer’s patient-derived cortical neurons
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..

    Article Title: Elevated SGK1 increases Tau phosphorylation and microtubule instability in Alzheimer's patient-derived cortical neurons.
    Article Snippet: FUW-M2rtTA (M2 reverse tetracycline-controlled transactivator) was purchased from Addgene (#20342). .. SGK1 shRNA sequence (CTGGAAGCTTAGCAATCTTAT) was selected from the TRC (RNAi Consortium) shRNA library (TRCN0000194957) and cloned into the pLKO.1 vector. pLKO.1-Scrambled control shRNA vector was purchased from Addgene (#136035). ..



    Similar Products

    93
    Addgene inc plko 1 scrambled control shrna vector
    Plko 1 Scrambled Control Shrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pm40921794-168-20-27
    Average 93 stars, based on 1 article reviews
    plko 1 scrambled control shrna vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc scramble shrna control vector
    Scramble Shrna Control Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pmc12358835__pnas%2E2425621122%2Esapp-30-1-5
    Average 93 stars, based on 1 article reviews
    scramble shrna control vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    OriGene pgfp plko 1 plasmids
    Pgfp Plko 1 Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/ppr0852086-123-20-29
    Average 96 stars, based on 1 article reviews
    pgfp plko 1 plasmids - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    OriGene tr30021 plko 1 sh scramble thermofisher sci
    Tr30021 Plko 1 Sh Scramble Thermofisher Sci, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pm38190411-416-40-38
    Average 96 stars, based on 1 article reviews
    tr30021 plko 1 sh scramble thermofisher sci - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    90
    Millipore scrambled shrna (mission® plko.1- puro empty vector control transduction particles
    Scrambled Shrna (Mission® Plko.1 Puro Empty Vector Control Transduction Particles, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/plko+1+vector/pm36648143-81-29-38
    Average 90 stars, based on 1 article reviews
    scrambled shrna (mission® plko.1- puro empty vector control transduction particles - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc control vector plko 1 scrambled shrna
    Control Vector Plko 1 Scrambled Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pm36116043-227-37-45
    Average 93 stars, based on 1 article reviews
    control vector plko 1 scrambled shrna - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Millipore plko.1 lentiviral vector expresses scramble shrna negative control
    Plko.1 Lentiviral Vector Expresses Scramble Shrna Negative Control, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/plko+1+vector/pm34965173-67-7-24
    Average 90 stars, based on 1 article reviews
    plko.1 lentiviral vector expresses scramble shrna negative control - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    Addgene inc 22rv1 cells plko 1 control scramble short hairpin rna shrna vector
    22rv1 Cells Plko 1 Control Scramble Short Hairpin Rna Shrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/scramble+shRNA+(Plasmid+%231864)/10__1158_slash_0008___5472__can___20___2969-111-10-20
    Average 96 stars, based on 1 article reviews
    22rv1 cells plko 1 control scramble short hairpin rna shrna vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc control vector plko 1
    Control Vector Plko 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scrambled+control+shrna+vector/scramble+shRNA+(Plasmid+%231864)/pmc07957825-387-1-7
    Average 96 stars, based on 1 article reviews
    control vector plko 1 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results